Article: Errata.(Vol. 6, No. 5 and Vol. 7, No. 1)(Correction Notice)

Vol. 6, No. 5

In the article, "Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska," by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene. The first complete sentence at the top of column 1, page 531, should read, "The following set of primers, which detects both [stx.sub.1] and [stx.sub.2], was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'." We regret any confusion this error may have caused.

Vol. 7, No. 1

In the International Update "Emerging Infectious Diseases in Russia, 1990-1999," by Sergey V. Netesov and J. Lyle ...

Related newspaper, magazine, and journal articles:

 
 
Newsweek Harper's Magazine The Washington Post Chicago Tribune Crain's Chicago Business PRNewswire Pediatric News The Nation Advertising Age The Economist (US) A FREE trial gives you access to over 80 million articles! Access over 6,500 publications with a FREE trial!