|
|
Article: Errata.(Vol. 6, No. 5 and Vol. 7, No. 1)(Correction Notice)
- Article from:
- Emerging Infectious Diseases
- Article date:
- May 1, 2001
CopyrightCOPYRIGHT 2001 U.S. National Center for Infectious Diseases. This material is published under license from the publisher through the Gale Group, Farmington Hills, Michigan. All inquiries regarding rights should be directed to the Gale Group. (Hide copyright information)
|
Vol. 6, No. 5
In the article, "Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska," by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene. The first complete sentence at the top of column 1, page 531, should read, "The following set of primers, which detects both [stx.sub.1] and [stx.sub.2], was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'." We regret any confusion this error may have caused.
Vol. 7, No. 1
In the International Update "Emerging Infectious Diseases in Russia, 1990-1999," by Sergey V. Netesov and J. Lyle ...
Related newspaper, magazine, and journal articles:
|
|
Article: Miramax Home Entertainment's KILL BILL Vol. 1 Sells 2 ...
Business Wire;
April 14, 2004 ;
700+ words
... ... availability, Miramax Home Entertainment's KILL BILL Vol. 1 sold 2 million combined units on DVD and ... The 2 million units sold to date has KILL BILL Vol. 1 "chopping" up its competition. KILL BILL Vol. 2 opens in theaters nationwide on Friday ...
|
|